View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15371_low_8 (Length: 408)
Name: NF15371_low_8
Description: NF15371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15371_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 266 - 398
Target Start/End: Complemental strand, 13998539 - 13998410
Alignment:
| Q |
266 |
ctcccccatgtcggtattgtatgtgaagtttgacatatagaaacaataggtggagaaaattgaactacttacaaagacagcatcatcaacccactgattt |
365 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
13998539 |
ctccctcatgtcggtattgtatgtgaagtttgacata--gaaacgataggtggagaaa-ttgaaccacttacaaagacagcatcatcaacccagtgattt |
13998443 |
T |
|
| Q |
366 |
gtgtttgtttacacgtaggtttttcttttcttt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13998442 |
gtgtttgtttacacgtaggtttttcttttcttt |
13998410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 13999092 - 13999006
Alignment:
| Q |
19 |
cttatgggcttgaaacctaaagaagaagcatgcgcatattatttgctttattttttagtattttgccgatcaaagaataaaactatt |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13999092 |
cttatgggtttgaaacctaaagaagaagcatgcgcatattatttgctttattttttagtattttgccgatcaaagaataaaactatt |
13999006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University