View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_12 (Length: 392)
Name: NF15372_low_12
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Complemental strand, 39912454 - 39912095
Alignment:
| Q |
1 |
cattcactactttggctctattcaaatcaaagaccaaagctcctgctaaggtactactcattttctatatatctttacnnnnnnnnnaatttcaaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39912454 |
cattcactactttggctctattcaaatcaaagaccaaagctcctgctaaggtactactcattttctatatatctttactttttttttaatttcaaattta |
39912355 |
T |
 |
| Q |
101 |
aataaaacattgttctaatttaaagcttcatgcatttcatttcataaaatatatttcaggttgttaaaaagccaaagccaaaggttgaagatggtatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39912354 |
aataaaacattgttctaatttaaagcttcatgcatttcatttcataaaatatatttcaggttgttaaaaagccaaagccaaaggttgaagatggtatctt |
39912255 |
T |
 |
| Q |
201 |
tggaacttctggaggatttggtttcactaagcagaatgaactctttgtgggtcgtgttgctatgatcggttttgcagtgagtaaatctttacctctctat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39912254 |
tggaacttctggaggatttggtttcactaagcagaatgaactctttgtgggtcgtgttgctatgatcggttttgcagtgagtaaatctttacctctctat |
39912155 |
T |
 |
| Q |
301 |
gatatattcactttaccataccaacttgtcttattttcattgcaattgtgacaacttgtg |
360 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39912154 |
gatatattcactttaccataacaacttgtcttattttcgttgcaattgtgacaacttgtg |
39912095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University