View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_16 (Length: 248)
Name: NF15372_low_16
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 56401584 - 56401372
Alignment:
| Q |
13 |
gagaagaataaatagatattttttaaccttcttaagcaattggctgcagataggtgctccggcacggaggagacgcattctggcacggtggtcgcggaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401584 |
gagaagaataaatagatattttttaaccttcttaagcaattggctgcagataggtgctccggcacggaggagacgcattctggcacggtggtcgcggaaa |
56401485 |
T |
 |
| Q |
113 |
ataagctctgacaggaactctggtttagggtttatgtttctggattctagaggagtccatccatcggcttaaaatcttggctgtaggtagtaataaaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
56401484 |
ataagctctgacaggaactctggtttagggtttatgtttctggattctagaggaatccatccatgggcttaaaatcttggttgtaggtagtaataaaaaa |
56401385 |
T |
 |
| Q |
213 |
ttaacttggtgca |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56401384 |
ttaacttggtgca |
56401372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University