View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_18 (Length: 240)
Name: NF15372_low_18
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 53 - 183
Target Start/End: Original strand, 17252227 - 17252356
Alignment:
| Q |
53 |
taatattagacaataactacacactatataggatatatataaggcttcttactctaattgcacgcacattttctcatgcaatcttgcaattnnnnnnncc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
17252227 |
taatattagacaataactacacactatataggatatataga-ggcttcttactgtaattgcacacacattttctcatgcaatcttgcaattaaaaaaacc |
17252325 |
T |
 |
| Q |
153 |
atggtcaaaatttatacatattataagaaat |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
17252326 |
atggtcaaaatttatacatattataataaat |
17252356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 57
Target Start/End: Original strand, 17252171 - 17252214
Alignment:
| Q |
14 |
atatgattataccaagccaaaagaaaccatatgcttcactaata |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17252171 |
atatgattataccaagccaaaagaaaccatatgcttcactaata |
17252214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University