View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_20 (Length: 236)
Name: NF15372_low_20
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 92 - 205
Target Start/End: Original strand, 4858001 - 4858114
Alignment:
| Q |
92 |
tttatctacttatttttaaagatgtaatttaagtatcaactatcaacaaaattggaatttaaggaaacataatcgagtagcaataaaaaatcacaattac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4858001 |
tttatctacttatttttaaagatgtaatttaagtatcaactatcaacgaaattggaatttaaggaaacataatcgagtagcaataaaaaatcacaattac |
4858100 |
T |
 |
| Q |
192 |
ctgctgttaggttg |
205 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4858101 |
ctgctgttaggttg |
4858114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 5176521 - 5176386
Alignment:
| Q |
28 |
gttgttgtgagtatgagtttttagtggattgagaatagcaatctcttcttcttcgaaacagaattttatctacttatttttaaagatgtaatttaagtat |
127 |
Q |
| |
|
|||||||||||||| ||| ||| |||| |||||||||||||||||| || |||||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
5176521 |
gttgttgtgagtatttgttcttaatggaatgagaatagcaatctcttgttt---gaaacagagttttatctgcttattttttaagatgtaatttaagtat |
5176425 |
T |
 |
| Q |
128 |
caactatcaacaaaattggaatttaaggaaacataatcg |
166 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
5176424 |
aaaatatcaacaaaatcggaatttaaggaaacataatcg |
5176386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University