View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_22 (Length: 226)
Name: NF15372_low_22
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_22 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 37087190 - 37086971
Alignment:
| Q |
7 |
ccaaaagcatggtatggtgtacctgggagccatgcttcagctatagaagatgcaatgaggaaacatttgcctgatttgtttgaagagcaaccaaatctac |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37087190 |
ccaaaagtatggtatggtgtacctgggagtcatgcttcagctatagaagatgcaatgaggaaacatttgcctgatttgtttgaagagcaaccaaatctac |
37087091 |
T |
 |
| Q |
107 |
tcaacgagttggtatgatccttgtactttcctcattgctgctattttttggtttctcttgtgcactttatcgtttccatgtgcataattcgtgaacaaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
37087090 |
tcaacgagttggtatgatccttgtactttcctcattgctgctattttttggtttcttttgtgcactttatcgtttccatgtacataattcatgaacaaag |
37086991 |
T |
 |
| Q |
207 |
agacatagttgatgcataat |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37086990 |
agacatagttgatgcataat |
37086971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 20675662 - 20675567
Alignment:
| Q |
15 |
atggtatggtgtacctgggagccatgcttcagctatagaagatgcaatgaggaaacatttgcctgatttgtttgaagagcaaccaaatctactcaa |
110 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||| ||||| ||||||||| ||| || |||||||||||||| || || ||||||||||||||| |
|
|
| T |
20675662 |
atggtatggagtacctggaagccatgcttctgctttagaaaatgcaatgaagaagcacttgcctgatttgttcgaggaagtaccaaatctactcaa |
20675567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University