View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15372_low_23 (Length: 218)
Name: NF15372_low_23
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15372_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 41976856 - 41977051
Alignment:
| Q |
18 |
tatctaatggatgaaatgtctagtcggcccgattttcctaaatgtagaaaaatcccggtccacattgaacccgtgtttttaactctacacttgcataagt |
117 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41976856 |
tatcttatggatgaaatgtctagtaggcccgattttcctaaatgtagaaaaatcccggtccacattgaacctgtgtttttaactctacacttgcataagt |
41976955 |
T |
 |
| Q |
118 |
ttttatttcatttctttatcagatgttaccataaacaattaatcattaatatatttttgcatttagtgcatttgttcttatgcaacaatgaataca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41976956 |
ttttatttcatttctttatcagatgttaccataaacaattaatcattaatatatttttgcatttagtgcatttgttcttatgcaacaatgaataca |
41977051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University