View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15373_low_12 (Length: 271)
Name: NF15373_low_12
Description: NF15373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15373_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 24 - 254
Target Start/End: Original strand, 42335803 - 42336031
Alignment:
| Q |
24 |
agcttgaacctcatgtttgcatacgggatatcttttataacttataactttacacttcaagtttacatactggatatctttgggagttgttgttatgcca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42335803 |
agcttgaacctcatgtttgcatacgggatatcttttataacttataactttacacttcaagtttacatactggatatctttgggagttg---ttatgcca |
42335899 |
T |
|
| Q |
124 |
aagaaagaaaatgattgcctttgattttaagatcgtagtcatggtgacatttagcatacacggatgatagaatttgtgtatcata-cccaattcaatatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42335900 |
aagaaagaaaatgattgcctttgattttaagatcgtagtcatggtgacatttagcatacacggatgatagaatttgtgtatcataccccaattcaatatt |
42335999 |
T |
|
| Q |
223 |
agccattgatttatatggtttcaattttcaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42336000 |
agccattgatttatatggtttcaattttcaat |
42336031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University