View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15374_high_7 (Length: 227)
Name: NF15374_high_7
Description: NF15374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15374_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 98 - 214
Target Start/End: Complemental strand, 42014987 - 42014868
Alignment:
| Q |
98 |
tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatattt---nnnnnnnnnnnnnnntggtatagttctgtatcccctaaacttct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42014987 |
tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatatttaaaaaaataaaataaaaatggtatagttctgtatcccctaaacttct |
42014888 |
T |
 |
| Q |
195 |
cttccatgtcacattcattt |
214 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
42014887 |
cttccatgtcacattgattt |
42014868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University