View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15374_low_12 (Length: 288)
Name: NF15374_low_12
Description: NF15374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15374_low_12 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 179 - 288
Target Start/End: Complemental strand, 48888367 - 48888258
Alignment:
| Q |
179 |
ggtgattaagctctcaagaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaattctggccaaaagaaaaacgacgaaatttttat |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48888367 |
ggtgattaagctctcaacaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaattctggccaaaagaaaaaagacgaaatttttat |
48888268 |
T |
|
| Q |
279 |
caatgtcaac |
288 |
Q |
| |
|
|||||||||| |
|
|
| T |
48888267 |
caatgtcaac |
48888258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 9 - 120
Target Start/End: Complemental strand, 48888536 - 48888425
Alignment:
| Q |
9 |
agcacagacagtaagaacctgtaannnnnnnnacttaatttaaactagaatgtaaatagcagcactgaacatctaaaatagcacaaataaattcataaca |
108 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888536 |
agcagagacagtaagaacctgtaattttttttacttaatttaaactagaatgtaaatagcagtactgaacatctaaaatagcacaaataaattcataaca |
48888437 |
T |
|
| Q |
109 |
tgttcctcctta |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48888436 |
tgttcctcctta |
48888425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University