View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15375_high_8 (Length: 223)
Name: NF15375_high_8
Description: NF15375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15375_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 46 - 205
Target Start/End: Original strand, 33606468 - 33606627
Alignment:
| Q |
46 |
gagaagtgaagtgaaatttgtaccnnnnnnnnncgacaagtgaaatatcaccaccaaactatatacttcgtacacagtttgagacaaattgatttgtacc |
145 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33606468 |
gagaagtgaagtgaaatttgtaccaaaaaaaaacgacaagtgaaatatcaccaccaaactatatacttcgtacacagtttgagacaaattgatttgtacc |
33606567 |
T |
 |
| Q |
146 |
ctctttagcattaatttagcttctttcataacggaatttcacacgttttttaacccacct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33606568 |
ctctttagcattaatttagcttctttcataacggaatttcacacgttttttaacccacct |
33606627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University