View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_high_26 (Length: 214)
Name: NF15376_high_26
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 43219477 - 43219416
Alignment:
| Q |
74 |
tccgtcaatgtcaatttagtttctataatgtacaatgtactatcaattaacacatggtttca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219477 |
tccgtcaatgtcaatttagtttctataatgtacaatgtactatcaattaacacatggtttca |
43219416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 43219524 - 43219478
Alignment:
| Q |
1 |
ttatccttgactctgtcaacattgctcattttcatccttttgtcaat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219524 |
ttatccttgactctgtcaacattgctcattttcatccttttgtcaat |
43219478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 43219372 - 43219335
Alignment:
| Q |
158 |
tttgttttagacttcattcactcttaggctgacctagg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219372 |
tttgttttagacttcattcactcttaggctgacctagg |
43219335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University