View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_low_24 (Length: 313)
Name: NF15376_low_24
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 28782956 - 28783248
Alignment:
| Q |
1 |
tttccgaacttggggtgatggaaaaagctctttggaggcaatggagggagcgttggaagaggtggacatggtggtttcttgaatggaggaagaacaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28782956 |
tttccgaacttggggtgatggaaaaagctctttggaggcaatggagggagcgttggaagaggtggacatggtggtttcttgaatggaggaagaataactg |
28783055 |
T |
|
| Q |
101 |
gtggtttgtatattggaacaacgggtggctttggaattactactggaggcttatatattggaacaggtggtagaactgggtgctcaatctttggtggaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28783056 |
gtggtttgtatattggaacaacgggtggctttggaattactactggaggcttatatattggaacaggtggtagaactgggtgctcaatctttggtggaca |
28783155 |
T |
|
| Q |
201 |
tggtttcttgatcgggactggtggtggaagtgcctttggaaccggtggaggtttgtatactggaacaggtggtaaaactggatgttcaacctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28783156 |
tggtttcttgatcgggactggtggtggaagtgcctttggaaccggtggaggtttgtatactggaacaggtggtaaaactggatgttcaacctt |
28783248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 144 - 293
Target Start/End: Original strand, 28783201 - 28783353
Alignment:
| Q |
144 |
tggaggcttatatattggaacaggtggtagaactgggtgctcaatctttggt---ggacatggtttcttgatcgggactggtggtggaagtgcctttgga |
240 |
Q |
| |
|
|||||| || |||| |||||||||||||| |||||| || |||| ||||||| |||||||||||||||| ||| || |||||||| ||| ||||||| |
|
|
| T |
28783201 |
tggaggtttgtatactggaacaggtggtaaaactggatgttcaacctttggtggtggacatggtttcttgaccggaaccggtggtggttgtggctttgga |
28783300 |
T |
|
| Q |
241 |
accggtggaggtttgtatactggaacaggtggtaaaactggatgttcaacctt |
293 |
Q |
| |
|
|| || |||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
28783301 |
actggaggaggtttgtatactggagcaggtggtagaactggatgttcaacctt |
28783353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 8 - 47
Target Start/End: Original strand, 28782870 - 28782909
Alignment:
| Q |
8 |
acttggggtgatggaaaaagctctttggaggcaatggagg |
47 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
28782870 |
acttggggtggtggaagaagctctttggaggcaatggagg |
28782909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 28782921 - 28782955
Alignment:
| Q |
8 |
acttggggtgatggaaaaagctctttggaggcaat |
42 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28782921 |
acttagggtgatggaaaaagctctttggaggcaat |
28782955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University