View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_low_25 (Length: 291)
Name: NF15376_low_25
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 43 - 277
Target Start/End: Complemental strand, 31601767 - 31601535
Alignment:
| Q |
43 |
agtctttcgtaagactaagtctccttccctaaaacttcaaggtttgtcctttaagatgaatctctttccaaccttgagtttgacaccatacacttttgag |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
31601767 |
agtctttcgtaagactaagtctccttccctaaaacttcaaggtttgtcctttaagatgaatctctttccaaccttgagtttgacacca--ctcttttgag |
31601670 |
T |
|
| Q |
143 |
tggtgctaagttaattttcatttctaattacatactaaaaactctcttccaagttatctactttctaaaagtatagctaaatatgtgaattttaataacc |
242 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31601669 |
tggtgctaggttaattttcatttctagtcacatactaaaaactctcttccaagttatctactttctaaaagtatagctaaatatgtgaattttaataacc |
31601570 |
T |
|
| Q |
243 |
attgcaactaattcacataagaatgcatattggtt |
277 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31601569 |
attgcaactaattcacataagaatggatattggtt |
31601535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University