View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_low_27 (Length: 278)
Name: NF15376_low_27
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 42 - 234
Target Start/End: Original strand, 55067549 - 55067741
Alignment:
| Q |
42 |
caagagatgaataaagaaataagatgcaatttttgttatggtattctctattttccatttcaatatgtctgtttcttataaatttataaacaaacaatct |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067549 |
caagagatgaataaagaaataagatgcaatttttgttgtggtattctctattttccatttctatatgtctgtttcttataaatttataaacaaacaatct |
55067648 |
T |
|
| Q |
142 |
ttttctttgttgaattttttaacctgtatgattatgttagaaacagagtgcaagggatactccaacctaattttagcgtataaataacataaa |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067649 |
ttttctttgttcaattttttaacctgtatgattatgttagaaacagagtgcaagggatactccaacctaattttagcgtataaataacataaa |
55067741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University