View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_low_29 (Length: 256)
Name: NF15376_low_29
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 12133355 - 12133174
Alignment:
| Q |
60 |
ttcagacacaaaacattgaccattacaattactacaacgtgaaagcaatcaaaaagtaaacaaaaa-gaaacaaggagaaaggtgatgagtaagaagaag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||| | |||||||||||||||||| |
|
|
| T |
12133355 |
ttcagacacaaaacattgaccattacaattactacaacgtgaaagcaatcaaaa-gtaaacaaaaaagaaacaagaagagaagtgatgagtaagaagaag |
12133257 |
T |
 |
| Q |
159 |
atattgattgtgggaggcacaggttacttgggtcagcatctattacaatcttattattctaatcaatctttgacagtggcatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12133256 |
atattgattgtgggaggcacaggttacttgggtcagcatctattacaatcttattattctaatcaatctctgacagtggcatt |
12133174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University