View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15376_low_30 (Length: 246)
Name: NF15376_low_30
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15376_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 37187890 - 37188104
Alignment:
| Q |
17 |
caaaggcggtgaatgttttgcacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37187890 |
caaaggcggtgaatgttttgcacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcat |
37187989 |
T |
|
| Q |
117 |
ccacctataccaaatccaaccatgcctttactttacccactcctcattcctcaccaactttcaacaccccatactatatcttcaattgaaccttcttgta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37187990 |
ccacctataccaaatccaaccatgcctttactttacccactcctcattcctcaccaactttcaacaccccatactatatcttcaattgaaccttcttgta |
37188089 |
T |
|
| Q |
217 |
actttcctttctttt |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37188090 |
actttcctttctttt |
37188104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 17 - 158
Target Start/End: Original strand, 53491918 - 53492053
Alignment:
| Q |
17 |
caaaggcggtgaatgttttgcacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcat |
116 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||| || ||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
53491918 |
caaaggcggtgaacgttttacacattaaatgtgtgactggctaatgggtatacagcatttcatgcacaaacgtgtgtgatgatatcatttgggtgggcat |
53492017 |
T |
|
| Q |
117 |
ccacctataccaaatccaaccatgcctttactttacccactc |
158 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
53492018 |
-----tataccaaa-ccaaccatgtctttactttacccactc |
53492053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University