View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15377_low_12 (Length: 240)
Name: NF15377_low_12
Description: NF15377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15377_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 42701592 - 42701800
Alignment:
| Q |
17 |
caaaggacagaaagactaacgttaaaaaatttgaaacttgtgactcgtgagctgtgagacatagcagcagcacacaacactgatattgtcacataaacat |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42701592 |
caaaagacagaaagactaacgttaaaaaatttgaaacttgtgactcgtgagctgtgagacatagcagcagcacacaacactgatattggcacataaacat |
42701691 |
T |
 |
| Q |
117 |
tagtagtgattttaaaaggaaaaaagtgataggttataaccagcaagtgtttgtgttgtatgtatatcaggcagcgtagagtgtcgaacatgtcttttac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701692 |
tagtagtgattttaaaaggaaaaaagtgataggttataaccagcaagtgtttgtgtcgtgtgtatatcaggcagcgtagagtgtcgaacatgtcttttac |
42701791 |
T |
 |
| Q |
217 |
ctaaattct |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
42701792 |
ctaaattct |
42701800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University