View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15377_low_13 (Length: 239)
Name: NF15377_low_13
Description: NF15377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15377_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3683150 - 3683374
Alignment:
| Q |
1 |
ctctcacggcggaggagaaaaggtggtggcagccggcaactattggtggtagtggttgttgcaaccaaggttgaaaagnnnnnnnnnngtttacggtcgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3683150 |
ctctcacggcggaggagaaaaggtggtggtagccagcaactattggtggtagtggttgttgcaaccaaggttgataa---aaaaaaaagtttacggtcgc |
3683246 |
T |
 |
| Q |
101 |
gattgcatttgattgaaaattctaatatcaaagattcagacgcgaccgtgatca------cgaattcatattaaccttggtggcaaaaatcatatgtaga |
194 |
Q |
| |
|
||||| |||| ||| ||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3683247 |
gattgtatttaattaaaaattctaatattaaagattcagacgcgaccgtgatcgtgatcccgaatttatattaaccttggtggcaaaaatcatatgtaga |
3683346 |
T |
 |
| Q |
195 |
ataatgtctttcggtggtatcaataaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3683347 |
ataatgtctttcggtggtatcaataaac |
3683374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University