View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15377_low_7 (Length: 277)
Name: NF15377_low_7
Description: NF15377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15377_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 24700463 - 24700214
Alignment:
| Q |
17 |
aaatttgataaaggtattacttcttggaacaattcatgaattaaatacaccgtgaaatcagttttgatttggcaattagagtaacatacggatggcatat |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24700463 |
aaatttgataaaggtattatttcttggaacaattcatgaattaaatacaccgtgaaatcagttttgatttggcaattagagtaacaaacggatggcatac |
24700364 |
T |
 |
| Q |
117 |
tttgttttgatttcagtttaaatagccacgaatatagtgaacacttttgaatatgattcaaattttatctcctgtaagcatgagttgttcacggttctgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24700363 |
tttgttttgatttcagtttaaatagccacgaatatagtgaacacttttgaatatgattcaaattttatctcctgtaagcatgagttgttcacggttctgt |
24700264 |
T |
 |
| Q |
217 |
ataacataagatgtatacatgatttatttgtcccgatctgttttggttcat |
267 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24700263 |
at-acataagatgtatacatgatttatttgtctcgatctgttttggttcat |
24700214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University