View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15378_high_13 (Length: 270)
Name: NF15378_high_13
Description: NF15378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15378_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 47832060 - 47832305
Alignment:
| Q |
9 |
gagatgaaccttgctgctcttttaacttctgctggaattaatatcattgtgtgtgtggtacttttttcactttattcaatattaagaaaacaaccaagta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47832060 |
gagatgaaccttgctgctcttttaacttctgctggaattaatatcattgtgtgtgtggtacttttttcactttattcaatattaagaaaacaaccaagta |
47832159 |
T |
 |
| Q |
109 |
atgttaatgtctactttggaagaagactagccactaggtcttcgacaaacgtcgacatttccttggaaagatttgttccctctcctacatgggtcatgaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47832160 |
atgttaatgtctactttggaagaagactagccactaggtcttcgacaaacgtcgacatttccttggaaagatttgttccctctcctacatgggtcatgaa |
47832259 |
T |
 |
| Q |
209 |
agcatgtgatacaactcaagatgaacttcttaatattggaggtttg |
254 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47832260 |
agcatgtgataccactcaagatgaacttcttaatattggaggtttg |
47832305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 4711233 - 4711117
Alignment:
| Q |
23 |
tgctcttttaacttctgctggaattaatatcattgtgtgtgtggtacttttttcactttattcaatattaagaaaacaaccaagtaatgttaatgtctac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| | |||||||| ||||| ||| |||||||||| || || ||||||||||| ||| |
|
|
| T |
4711233 |
tgctcttttaacttctgctggaattaatatcgctgtgtgtgtggtgatcttttcactatattcgatactaagaaaacagcccagcaatgttaatgtgtac |
4711134 |
T |
 |
| Q |
123 |
tttggaagaagactagc |
139 |
Q |
| |
|
|||| | | |||||||| |
|
|
| T |
4711133 |
tttgcacggagactagc |
4711117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University