View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15378_high_14 (Length: 268)

Name: NF15378_high_14
Description: NF15378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15378_high_14
NF15378_high_14
[»] chr3 (1 HSPs)
chr3 (18-148)||(54702661-54702791)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 54702791 - 54702661
Alignment:
18 tgtacatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagcttcatctagagatacacagttttgaaaaa 117  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54702791 tgtatatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagcttcatctagagatacacagttttgaaaaa 54702692  T
118 taaataaattcaaatgcatattgcatgttta 148  Q
    |||||||||||||||||||||||||||||||    
54702691 taaataaattcaaatgcatattgcatgttta 54702661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University