View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15378_low_19 (Length: 324)
Name: NF15378_low_19
Description: NF15378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15378_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 23 - 311
Target Start/End: Original strand, 1373915 - 1374203
Alignment:
| Q |
23 |
cggccaaggtcacagtcacaaatttgtatttaaaacccttttaatttgtgtgtggccgatgtggcctcaattgctgtcgaactgcggtttcaataacatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1373915 |
cggccaaggtcacagtcacaaatttgtatttaaaacccttttaatttgtgtgtggccgatgtggcctcaattgctgtcgaactgcggtttcaataacatc |
1374014 |
T |
|
| Q |
123 |
aaaaaccgttatgtcgcgaccctgattgtggtcacggacctttatttaaaatccatttgagttttgatggttaacatatgtttgttttgacttctacttg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374015 |
aaaaaccgttatgtcgcgaccctgatcgtggtcacggacctttatttaaaatccatttgagttttgatggttaacatatgtttgttttgacttctacttg |
1374114 |
T |
|
| Q |
223 |
cttacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1374115 |
cttacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcct |
1374203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 225 - 311
Target Start/End: Original strand, 1358565 - 1358651
Alignment:
| Q |
225 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1358565 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcct |
1358651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 225 - 311
Target Start/End: Original strand, 1394664 - 1394750
Alignment:
| Q |
225 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1394664 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcct |
1394750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 225 - 311
Target Start/End: Original strand, 1350659 - 1350745
Alignment:
| Q |
225 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1350659 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcct |
1350745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 225 - 311
Target Start/End: Original strand, 1384313 - 1384399
Alignment:
| Q |
225 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1384313 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcct |
1384399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 225 - 311
Target Start/End: Original strand, 1390418 - 1390504
Alignment:
| Q |
225 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1390418 |
tacttgcagaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcct |
1390504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 232 - 311
Target Start/End: Original strand, 7007237 - 7007316
Alignment:
| Q |
232 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7007237 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttactggacaatgtggaagttgcct |
7007316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 232 - 311
Target Start/End: Original strand, 7010315 - 7010394
Alignment:
| Q |
232 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatactacgacggacgttactggacaatgtggaagttgcct |
311 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7010315 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttactggacaatgtggaagttgcct |
7010394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University