View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15378_low_26 (Length: 268)
Name: NF15378_low_26
Description: NF15378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15378_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 54702791 - 54702661
Alignment:
| Q |
18 |
tgtacatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagcttcatctagagatacacagttttgaaaaa |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702791 |
tgtatatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagcttcatctagagatacacagttttgaaaaa |
54702692 |
T |
 |
| Q |
118 |
taaataaattcaaatgcatattgcatgttta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54702691 |
taaataaattcaaatgcatattgcatgttta |
54702661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University