View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15379_high_6 (Length: 285)
Name: NF15379_high_6
Description: NF15379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15379_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 43965444 - 43965212
Alignment:
| Q |
20 |
tggtggatatgatttagatagagcctgtagacaagattttcttgacaaaaattaaaaacaaagaataaggacttcttttcatgttaaccctcaagttttt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43965444 |
tggtggatatgatttagatagagcctgtagacaagattttcttgacaaaaattaaaaacaa-------ggacttcttttcatgttaaccctcaagttttt |
43965352 |
T |
 |
| Q |
120 |
aggggaatgcgaccttggtagagctcggccataaagtaaatataacctcattaaaaattgttaatcgaatacggtatctctcttgaataattcattcatt |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43965351 |
aggggaatgagaccttggtagagctcggccataaagtaaatataacctcattaaaaattgttaatcgaatacggtatctctcttgaataattcattcatt |
43965252 |
T |
 |
| Q |
220 |
aatagagttcattaaccacttgacctcaattgtttgatca |
259 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43965251 |
aatagagttcattaaccacttgatctcaattgtttgatca |
43965212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University