View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1537_low_2 (Length: 246)
Name: NF1537_low_2
Description: NF1537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1537_low_2 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 3 - 246
Target Start/End: Original strand, 1803277 - 1803525
Alignment:
| Q |
3 |
gatgtcgaaaaatatatcattgagag-----aacttataaattaaatgtctttaagatttttggttaagatgtgttgtcaaactctctcgttttattatt |
97 |
Q |
| |
|
||||| ||| |||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803277 |
gatgttgaagaatatatcattgagaggacttagcttataaattaaatgtctttaaagtttttggttaagatgtgttgtcaaactctctcgttttattatt |
1803376 |
T |
|
| Q |
98 |
cttgatctaatatagtagatgaacccccgtgctttcttcatgacccaacaggcgaccgactccttgtgtcagaagtctttctatcaatggtttcatgcga |
197 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| |||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1803377 |
cttgatctaatatagtagatgaacccctatacttttttcatgacccaacatgtgaccgactccttgtgtcagaagtctttttatcaatggtttcatgcga |
1803476 |
T |
|
| Q |
198 |
catatagctcctacgtgagggagagcataacaaaataattgacggacgc |
246 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803477 |
catatccctcctacgtgagggagagcataacaaaataattgacggacgc |
1803525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University