View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1537_low_4 (Length: 236)
Name: NF1537_low_4
Description: NF1537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1537_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 1803538 - 1803759
Alignment:
| Q |
1 |
attattgttgtagtaaatgcgacttagaagtagcaaatatataagtgggaagaattgattaaaatggaaattttgaaggttgagagattgattttataga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1803538 |
attattgttgtagtaaatgcgacttagaagtagcaaatatataagtgggaagaattgattaaaatggatattttgaaggttgagagattgattttataga |
1803637 |
T |
|
| Q |
101 |
catccaagtttctttgatggagatgaat--gcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803638 |
catccaagtttctttgatggagatgaatgcgcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctt |
1803737 |
T |
|
| Q |
199 |
tgatgagtcaatgtgtcttaaa |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1803738 |
tgatgagtcaatgtgtcttaaa |
1803759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University