View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1537_low_4 (Length: 236)

Name: NF1537_low_4
Description: NF1537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1537_low_4
NF1537_low_4
[»] chr6 (1 HSPs)
chr6 (1-220)||(1803538-1803759)


Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 1803538 - 1803759
Alignment:
1 attattgttgtagtaaatgcgacttagaagtagcaaatatataagtgggaagaattgattaaaatggaaattttgaaggttgagagattgattttataga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
1803538 attattgttgtagtaaatgcgacttagaagtagcaaatatataagtgggaagaattgattaaaatggatattttgaaggttgagagattgattttataga 1803637  T
101 catccaagtttctttgatggagatgaat--gcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctt 198  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1803638 catccaagtttctttgatggagatgaatgcgcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctt 1803737  T
199 tgatgagtcaatgtgtcttaaa 220  Q
    ||||||||||||||||||||||    
1803738 tgatgagtcaatgtgtcttaaa 1803759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University