View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15382_high_6 (Length: 303)
Name: NF15382_high_6
Description: NF15382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15382_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 39612139 - 39611868
Alignment:
| Q |
19 |
ccaaatacttgctctttgaaagcctctcttcataaatgttcaacaccttcaccaactttgcttcactctcttcaattacctttggatctggagtgccgtc |
118 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612139 |
ccaaatacttgttctttgatagtctctcttcataaatgttcaacaccttcaccaactttgcttcactctcttcaattacctttggatctggagtgccgtc |
39612040 |
T |
 |
| Q |
119 |
aactagtagtgaaggaaacaaaacatgaatgaccaagttgtaagctggtgggttaaagttgtgtgcttcaacttctaaccattgttccacaagacccttt |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612039 |
aaccagtagtgaaggaaacaaaacatgaatgaccaagttgtaagctggtgggttaaagttgtgtgcttcaacttctaaccattgttccacaagacccttt |
39611940 |
T |
 |
| Q |
219 |
tcttctattgtctttcctagcaactcaaccccttgagatctatatttttctgcataatatctcattattgcc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39611939 |
tcttctattgtctttcctagcaactcaaccccttgagatctatatttttctgcataatatctcattattgcc |
39611868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 39601318 - 39601047
Alignment:
| Q |
19 |
ccaaatacttgctctttgaaagcctctcttcataaatgttcaacaccttcaccaactttgcttcactctcttcaattacctttggatctggagtgccgtc |
118 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| || | | |
|
|
| T |
39601318 |
ccaaatacttgttctttgatagcctctcttcataaatgttgaacaccttcaccaactttgcttcactttcttcaattacctttggatctggagagctgcc |
39601219 |
T |
 |
| Q |
119 |
aactagtagtgaaggaaacaaaacatgaatgaccaagttgtaagctggtgggttaaagttgtgtgcttcaacttctaaccattgttccacaagacccttt |
218 |
Q |
| |
|
| ||||||||| |||| ||||||||||| | ||| ||||| |||| ||||| || || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39601218 |
acctagtagtgtaggacacaaaacatgacaggtcaaattgtatgctgatgggtggaaattatgtgcttcaacttctaaccattgttccacaagacccttt |
39601119 |
T |
 |
| Q |
219 |
tcttctattgtctttcctagcaactcaaccccttgagatctatatttttctgcataatatctcattattgcc |
290 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39601118 |
tcttctattgtctttcctagtaactcaaccccttgagatctatatttttcagcatagtatctcattattgcc |
39601047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 164 - 254
Target Start/End: Complemental strand, 17647195 - 17647105
Alignment:
| Q |
164 |
tggtgggttaaagttgtgtgcttcaacttctaaccattgttccacaagacccttttcttctattgtctttcctagcaactcaaccccttga |
254 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||| |||||||||||| ||||||||||||||||||| ||||| ||| ||||||| |
|
|
| T |
17647195 |
tggtgggttgaagttatgtgcttcaacttctagccattgctccacaagacccctttcttctattgtctttccaagcaaatcagtcccttga |
17647105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 17572922 - 17573025
Alignment:
| Q |
134 |
aaacaaaacatgaatgaccaagttgtaagctggtgggttaaagttgtgtgcttcaacttctaaccattgttccacaagacccttttcttctattgtcttt |
233 |
Q |
| |
|
||||| ||||| ||||||||| |||| || ||||| |||||| |||||||| ||||| | ||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
17572922 |
aaacagaacattgatgaccaagctgtagattgctgggtgaaagttatgtgcttccacttcaagccattgttccacaagacccctttcttctaccgtcttt |
17573021 |
T |
 |
| Q |
234 |
ccta |
237 |
Q |
| |
|
|||| |
|
|
| T |
17573022 |
ccta |
17573025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 65 - 146
Target Start/End: Complemental strand, 34774411 - 34774330
Alignment:
| Q |
65 |
cttcaccaactttgcttcactctcttcaattacctttggatctggagtgccgtcaactagtagtgaaggaaacaaaacatga |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| ||||| || |||||||||||||| |||||||||| |
|
|
| T |
34774411 |
cttcaccaactttgcttcactctcttcaattaccttaggctctggattgccgccagctagtagtgaaggacgcaaaacatga |
34774330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University