View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15383_low_4 (Length: 247)
Name: NF15383_low_4
Description: NF15383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15383_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 51687242 - 51687473
Alignment:
| Q |
1 |
tgtagatgcttttctgtaaaggaagaatggaat-ggatgcaattaaaaacatataaattaaacaagtaaacaaagtaaggcacagtgaacgcaaggtttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
51687242 |
tgtagatgcttttctgtaaaggaagaatggaattggatgcaattaaaaacatataaattaaacaagt---------aaggcacggtgaacgcaaggtttg |
51687332 |
T |
|
| Q |
100 |
tgattttggttaaaccaagatttaaagtgatcaaatcttcaaccaaaagatttgtcaaaagaagactcgtatatgnnnnnnnagtgtctaacaacttcag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
51687333 |
tgattttggttaaaccaagatttaaagtgatcaaatcttcaaccaaaagatttgtcaaaagaagactcgtatatgtttttttagtgtctaacaacttaag |
51687432 |
T |
|
| Q |
200 |
ataaggtcgaattggtaaaaaatgttcgagtttgacctttg |
240 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51687433 |
ataaggtcgaattggtagaaaatgttcgagtttgacctttg |
51687473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University