View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15384_low_7 (Length: 252)
Name: NF15384_low_7
Description: NF15384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15384_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 149 - 239
Target Start/End: Complemental strand, 40255983 - 40255893
Alignment:
| Q |
149 |
gacattattggcataaattttaaataagttatctacaactaaatacttaaaattaaattggtccaaaatattaatgtcaaactggtcccct |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40255983 |
gacattattggcataaattttaaatgagttatctacaactaaatacttaaaattaaattggtccaaaatattaatgtcaaactggtcccct |
40255893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 40256127 - 40256051
Alignment:
| Q |
1 |
tttgctgaaattgaaattgttaatttaagcaaaatgcatcccaagttggtggagcttgagatgaaaaaattgaagac |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256127 |
tttgctgaaattgaaattgttaatttaagcaaaatgcatcccaagttggtggagcttgagatgaaaaaattgaagac |
40256051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University