View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15386_low_6 (Length: 270)
Name: NF15386_low_6
Description: NF15386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15386_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 29959845 - 29959662
Alignment:
| Q |
1 |
ttaattggtacacattggtaaaactatatatggttggtcttacatcaatggaattgactttcttgggagcttttcttgccgtctgggacattgttgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959845 |
ttaattggtacacattggtaaaactatatatggttggtcttacatcaacggaattgactttcttgggagcttttcttgccgtctgggacattgttgttct |
29959746 |
T |
|
| Q |
101 |
tttgctgtaccttgataataatcacactgaaaaagaaaattgcatcatactgataattaaattttgacagtgatctcgtagact |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
29959745 |
tttgctgtaccttgataataatcacactgaaaaagaaaattgcatcacattgataattaaattttgacagtgatctcgtagact |
29959662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University