View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15386_low_8 (Length: 253)
Name: NF15386_low_8
Description: NF15386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15386_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 29959907 - 29960127
Alignment:
| Q |
1 |
tctagacatgtaattcaattaaaaatactagctagtcgatatgtacattttgtgggtcactctattgtccccctttcagggtagaaaatgacttcaactg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959907 |
tctagacatgtaattcaatgaaaaatactagctagtaaatatgtacattttgtgggtcactctattgtccccctttcagggtagaaaatgacttcaa--- |
29960003 |
T |
 |
| Q |
101 |
aaagtttagtgccttttaatccgattcacacttgacccaattaaaaatagcttctattcaaatgtaaccacatatctaaaattggaaaactatcttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29960004 |
--------gtgccttttaatccgattcacacttgacccaattaataatagcttctattcaaatgtaaccacatatctaaaattggaaaactatcttctct |
29960095 |
T |
 |
| Q |
201 |
agaaaatttaatttctttagtactatacaatg |
232 |
Q |
| |
|
|| |||||||||||||||||||||||| |||| |
|
|
| T |
29960096 |
aggaaatttaatttctttagtactatagaatg |
29960127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University