View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15388_high_10 (Length: 233)
Name: NF15388_high_10
Description: NF15388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15388_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 33303799 - 33303574
Alignment:
| Q |
1 |
acaacagatagatcacaagaaggtgatgaagagtctcaacctgcaaaatacaatctgcaatgaagagcattgacatgatgttcatctctgnnnnnnnnnn |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
33303799 |
acaacagatggatcacaagaaggtgatgaagagtctcaacctgcaaaatacaatctgcaatgaagagcattgacattatgttcatctccgttttttgttt |
33303700 |
T |
 |
| Q |
101 |
nnnnngaagtaatgtcattttttcaaattattattagtgtcgat------gtgtccgtatcgtgtctggcgtccgtatgggtgcttgataaaataaaaac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33303699 |
tttttgaagtaatgtcattttttcaaattattattagtgtcgatgtgtcagtgtccgtatcgtgtctggtgtccgtatgggtgcttgataaaataaaaac |
33303600 |
T |
 |
| Q |
195 |
attttaaggaacactttatcagtgaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33303599 |
attttaaggaacactttatcagtgaa |
33303574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 41319340 - 41319390
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgtatcgtgtctg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
41319340 |
atgtcattttttcaaattattattggtgtcgacgtgtccgtgtcgtgtctg |
41319390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 11093599 - 11093559
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgt |
152 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
11093599 |
atgtcattttttcaaattattatcagtgtaaatgtgtccgt |
11093559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 46191375 - 46191415
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgt |
152 |
Q |
| |
|
|||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
46191375 |
atgtgattttctcaaattattattggtgtcgatgtgtccgt |
46191415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 32340670 - 32340720
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgtatcgtgtctg |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
32340670 |
atgtcattttttcaaattattattagtatcggcgtgaccgtatcgtgtctg |
32340720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 155
Target Start/End: Original strand, 34201076 - 34201119
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgtatc |
155 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||| |
|
|
| T |
34201076 |
atgtcattttctcaaattattattagtgtcaatgtgtcggtatc |
34201119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 41141664 - 41141698
Alignment:
| Q |
115 |
tcattttttcaaattattattagtgtcgatgtgtc |
149 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41141664 |
tcattttttcaaattattattggtgtcgatgtgtc |
41141698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 143
Target Start/End: Complemental strand, 4344900 - 4344869
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4344900 |
atgtcattttttcaaattattattagtgtcga |
4344869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 31243578 - 31243636
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtccgtatcgtgtctggcgtccgt |
170 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| | || |||||||| | |||||| |
|
|
| T |
31243578 |
atgtcattttctcaaattattataagtgtcgatgtgcctgtgtcgtgtcttgtgtccgt |
31243636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 149
Target Start/End: Original strand, 927867 - 927904
Alignment:
| Q |
112 |
atgtcattttttcaaattattattagtgtcgatgtgtc |
149 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
927867 |
atgtcattttctcaaattattattagtgtcgacgtgtc |
927904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University