View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15388_high_9 (Length: 239)
Name: NF15388_high_9
Description: NF15388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15388_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 42682124 - 42682343
Alignment:
| Q |
16 |
tttaaacaaatgacttgccaacaaactatttcatcagaaacataatcaacatgaaatgacaattcttcatcaactttaaagggacacaaccaactaacgg |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42682124 |
tttaaacaaatgacctgccaacaaactatttcatcagaaacataatcaacatgaaatgacaattcttcatcaactttaaagggacacaaccaactaacgg |
42682223 |
T |
|
| Q |
116 |
tattaaataaaagaaatatggctgttatatatgacacaattaaactaataacggaccaaaatctcgaattttgacgatcaaaatcttcaatatatgtaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42682224 |
tattaaataaaagaaatatggctgttagatatgacataattagactaataacgaactaaaatctcgaattttgacgatcaaaatcttcaatatatgtaaa |
42682323 |
T |
|
| Q |
216 |
tttgagaaactatcctttca |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42682324 |
tttgagaaactatcctttca |
42682343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University