View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15388_low_4 (Length: 416)
Name: NF15388_low_4
Description: NF15388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15388_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 133 - 401
Target Start/End: Original strand, 47219570 - 47219838
Alignment:
| Q |
133 |
atcttattatgtttttagttctcctttatttcagaaatgatgtgtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47219570 |
atcttattatgtttttagttctcctttatttaagaaatgatgggtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
47219669 |
T |
|
| Q |
233 |
actctataggggaaggaaggattaggtatcagtttggttcccagaattgggattatctttctttcttatgcatttgtgagtgagagcataatgatcctta |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47219670 |
actctataggggaaggaaggattaggtatcagtttggttctcagaattgggattatctttctttcttatgcatttgtgaatgagagcataatgatcctta |
47219769 |
T |
|
| Q |
333 |
taaaattccaatgctggatgaccctaagtgactagcctaatcattgcttcatttttggttgtaaggact |
401 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47219770 |
taaaattccaatgctggatgacccaaagtgactagcctaatcattgcttcatttttggttgtaaggact |
47219838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 47219502 - 47219566
Alignment:
| Q |
9 |
gagatgaaggtttagtctatttctctacttgttctcaatttcctctttctcgctttttactttct |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47219502 |
gagatgaaggtttagtctattactctacttgttctcaatttcctctttctcgcttttttctttct |
47219566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University