View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15389_high_5 (Length: 239)
Name: NF15389_high_5
Description: NF15389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15389_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 36 - 225
Target Start/End: Complemental strand, 31659489 - 31659300
Alignment:
| Q |
36 |
gtgtacgtattgacagatgaccggctaaataattcatttaaggcgcaattaacaaaccatatagccattgtaattttccatgcttataaatacatagcca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31659489 |
gtgtacgtattgacagatgaccggctaaataattcatttaaggcgcaattaacaaaccatatagccattgtaattttccatgcttataaatacatagcca |
31659390 |
T |
|
| Q |
136 |
taatcaagtatacttcactctaaaatttgtccaattacttgctaattagaaatcaagtagcgaaaatgatgaacatgaaggttgtgtgtg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31659389 |
taatcaagtatacttcactctaaaatttgtccaattacttgctaattagaaatcaagtagtgaaaatgatgaacatgaaggttgtgtgtg |
31659300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 86 - 225
Target Start/End: Complemental strand, 31672169 - 31672031
Alignment:
| Q |
86 |
aacaaaccatatagccattgtaattttccatgcttataaatacatagcca--taatcaagtatacttcactctaaaatttgtccaattacttgctaatta |
183 |
Q |
| |
|
||||| ||| ||||||||| ||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
31672169 |
aacaacccacatagccattataactttccatgcttataaatacatagccaattaatcaagtatactccactctaaaatttgtccaattactagctaatta |
31672070 |
T |
|
| Q |
184 |
gaaatcaagtagcgaaaatgatgaacatgaaggttgtgtgtg |
225 |
Q |
| |
|
|| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
31672069 |
ga---gaagtagtgaaaatgatgaagatgaaggttgtgtgtg |
31672031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University