View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15389_low_6 (Length: 284)
Name: NF15389_low_6
Description: NF15389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15389_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 147 - 279
Target Start/End: Complemental strand, 43029691 - 43029559
Alignment:
| Q |
147 |
cactcacttgctggaagacagacagatagtcacagagtgatggattgatggggccaattggttttaaaaagtgtcatgttttctcatttgtcactttctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43029691 |
cactcacttgctggaagacagacagatagtcacagagtgatggattgatggggccaattggtttttaaaagtgtcatgttttctcatttgtcactttctc |
43029592 |
T |
|
| Q |
247 |
tttggtttatataatgttaatgcctttgcttct |
279 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| |
|
|
| T |
43029591 |
tttggtttatgtaatgttaatgcctttgattct |
43029559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 87
Target Start/End: Complemental strand, 43029823 - 43029751
Alignment:
| Q |
15 |
ggagaagaaggaggtggagaaaagacagaatcatggtcttctccattttgggatgtagatacagaatgattct |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029823 |
ggagaagaaggaggtggagaaaagacagaatcatggtcttctccattttgggatgtagatacagaatgattct |
43029751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University