View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1538_high_19 (Length: 265)
Name: NF1538_high_19
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1538_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 36 - 250
Target Start/End: Original strand, 41446518 - 41446732
Alignment:
| Q |
36 |
gaaaggttcaatgaaaaaagggtaattttagaagctgaagaaacggatagtgatgaagatgaagatgttggagaactaaaacagagtgttgaaagtgtaa |
135 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41446518 |
gaaaggtttattgaaaaaagggtaattttagaagctgaagaaacggatagtgatgaagatgaagatgttggagaactaaaacagagtgttaaaagtgtaa |
41446617 |
T |
 |
| Q |
136 |
aaacagaggaaccaagttcttcatctttgagtggtggcatagacacggggagtgatgaaggacctgatgtggataaaaaagctgatgaattcattgccaa |
235 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41446618 |
aaacagaggaaccatgttcttcatctttgagtggtggcatagacacagtgagtgatgaaggacctgatgtggataaaaaagctgatgaattcattgccaa |
41446717 |
T |
 |
| Q |
236 |
attcagagaacaaat |
250 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41446718 |
attcagagaacaaat |
41446732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University