View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1538_high_37 (Length: 202)
Name: NF1538_high_37
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1538_high_37 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 3e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 5 - 202
Target Start/End: Complemental strand, 51808591 - 51808393
Alignment:
| Q |
5 |
aactttatcaacaatatgttgacagcaaagtttgcatctgatacgatatgaatgaaccgtgtgcatctattttcaacggtcaatctcaggtcaa-taaca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51808591 |
aactttatcaacaatatgttgacagcaaaatttgcatctgatacgatatgaatgaaccatgtgcatctattttcaacggtcaatctcaggtcaaataaca |
51808492 |
T |
 |
| Q |
104 |
actgtaatttcgttgcatgttgtatgttatatcttaaattctttgttattatgcactaatagtggacttgttatattcatctactcttgattgagaaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51808491 |
actgtaatttcgttgcatgttgtatgttatatcttaaattctttgttattatgcactaatagtggacttgttatattcatctactcttgattgagaaat |
51808393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 42
Target Start/End: Complemental strand, 51804679 - 51804639
Alignment:
| Q |
2 |
aacaactttatcaacaatatgttgacagcaaagtttgcatc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
51804679 |
aacaactttatcaacaatatgttgacagccaagtttacatc |
51804639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 129 - 186
Target Start/End: Complemental strand, 51804516 - 51804460
Alignment:
| Q |
129 |
gttatatcttaaattctttgttattatgcactaatagtggacttgttatattcatcta |
186 |
Q |
| |
|
||||||||||||||||||| | |||||| |||| |||||||||||| |||||||||| |
|
|
| T |
51804516 |
gttatatcttaaattctttatg-ttatgctctaagagtggacttgttctattcatcta |
51804460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University