View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1538_low_17 (Length: 290)
Name: NF1538_low_17
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1538_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 273
Target Start/End: Original strand, 47037326 - 47037593
Alignment:
| Q |
11 |
catcatcaagataacatagttcacaaaaaacgcaagtgtcttcnnnnnnncatattgctatagagtgattagaatgattttgtttgtcaagcaacaacta |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037326 |
catcatcaagataatatagttcacaaaaaacgcaagtgtcttaaaaaaaacatattgatatagagtgattagaatgattttgtttgtcaagcaacaaccg |
47037425 |
T |
 |
| Q |
111 |
cctcaacgcgaattggagcaatgaccgtcaatatgcgagttgtgagtatttgcacacacttttacgctcaagctaataaaag-----agagtgagaggtt |
205 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
47037426 |
cctcaatgcgaattggagcaataaccgtcaatatgcgagttgtgagtatttgcagacacttttacgctcaagctagtaaaagagcaaagagtgagaggtt |
47037525 |
T |
 |
| Q |
206 |
aaactttatattgttagtaccttttgatggctaacagtgcctttttataggcgttgatggtctattga |
273 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47037526 |
aaactttatattgtaattaccttttgatggctaacagtgcctttttataggtgttgatggtctattga |
47037593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University