View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1538_low_25 (Length: 256)
Name: NF1538_low_25
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1538_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 100 - 240
Target Start/End: Complemental strand, 40033790 - 40033659
Alignment:
| Q |
100 |
tatctaactatcctaaatgataagaacacatcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagttactcagaaac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033790 |
tatctaactatcctaaatgataagaacacatcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagttactcagaaac |
40033691 |
T |
 |
| Q |
200 |
cctagaaccggtagagaaaatgaaatggtgagagaataaac |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
40033690 |
cc---------tagagaaaatgaaatggtgagagaataaac |
40033659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 40033874 - 40033834
Alignment:
| Q |
22 |
cataaacttaagcataaacattattatcatgatcgaatacg |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033874 |
cataaacttaagcataaacattattatcatgatcgaatacg |
40033834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University