View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15390_low_2 (Length: 416)
Name: NF15390_low_2
Description: NF15390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15390_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 176 - 401
Target Start/End: Complemental strand, 2288619 - 2288394
Alignment:
| Q |
176 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288619 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
2288520 |
T |
|
| Q |
276 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288519 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
2288420 |
T |
|
| Q |
376 |
tatgcctatatgattgttttggatat |
401 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2288419 |
tatgcctatatgattgttttggatat |
2288394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 15 - 130
Target Start/End: Complemental strand, 2288759 - 2288644
Alignment:
| Q |
15 |
aatatcgctggttatcacgtggtcactaagtaactatacaaaggtgaaagagttgatgagattacagaaacagttgaaagatgggtatctcaccgacata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2288759 |
aatatcgctggttatcacgtggtcactaagtaactatacaaaggtgaaagagttgatgagattacagaaacagttgaaagattggtatctcaccgacata |
2288660 |
T |
|
| Q |
115 |
cttatgaaatttaact |
130 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2288659 |
cttatgaaatttaact |
2288644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 280 - 348
Target Start/End: Complemental strand, 670502 - 670434
Alignment:
| Q |
280 |
tggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactat |
348 |
Q |
| |
|
||||||| ||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
670502 |
tggatgggttgctagagcctagaggtctattagattacatgctttccagttttctaattaaagaactat |
670434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 351 - 397
Target Start/End: Complemental strand, 2288378 - 2288332
Alignment:
| Q |
351 |
tttatgctttttgattaagcttgattatgcctatatgattgttttgg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2288378 |
tttatgctttttgattaagcttgattatgcctatatgattgtattgg |
2288332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 62 - 176
Target Start/End: Complemental strand, 670720 - 670605
Alignment:
| Q |
62 |
aagagttgatgagattacagaaacagttgaaagatgggtatctcaccgacatacttatgaaattta--actcccgttcatttttattatgaatgaactat |
159 |
Q |
| |
|
||||||| |||||||| |||||| |||||||| || ||||| | ||| || ||| | ||||| || ||||| |||| ||||||| ||||||||||||| |
|
|
| T |
670720 |
aagagttaatgagattgcagaaatagttgaaa-attggtattttaccaacctacaaaggaaatatattactccagttcgtttttataatgaatgaactat |
670622 |
T |
|
| Q |
160 |
ttaaagtgggcttgttt |
176 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
670621 |
ttaaagtgggtttgttt |
670605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 178 - 212
Target Start/End: Complemental strand, 14470304 - 14470270
Alignment:
| Q |
178 |
gacgttaccaaaagacaatggttgcattcctgatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14470304 |
gacgttaccaaaagacaatggttgcattcttgatg |
14470270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 189 - 233
Target Start/End: Complemental strand, 670579 - 670535
Alignment:
| Q |
189 |
aagacaatggttgcattcctgatggtactataatttgcagaacaa |
233 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| ||||||||||| |
|
|
| T |
670579 |
aagacaatggttacattccttatggaactataacttgcagaacaa |
670535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University