View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15390_low_5 (Length: 305)
Name: NF15390_low_5
Description: NF15390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15390_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 32835597 - 32835365
Alignment:
| Q |
16 |
cttttgtctactgtattgacattcttgaatgacatatatacgattcttgaatttggatttgactgtaattgcatcatgggggagtttaaaggattaatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32835597 |
cttttgtctactgtattgacattcttgaatgacatatatacgattcttgaatgtggatttgactgtaattgcatcatgagggagtttaaaggattaatat |
32835498 |
T |
 |
| Q |
116 |
atattgatcaacaagttagttagacactatttaaattaaaatcttaaggctttcgatcaatgtgggacttttgattaatatgaatcatgccgtttatatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32835497 |
atattgatcaacaagttagttagacactatttaaattaaaatcttaaggctttcgatcaatgtgggacttttgattaatatgaatcatgccgtttatatg |
32835398 |
T |
 |
| Q |
216 |
ttgtttaccattctctttttcatctagtgtgag |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
32835397 |
ttgtttaccattctcttttttatctagtgtgag |
32835365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 241 - 295
Target Start/End: Complemental strand, 32835357 - 32835303
Alignment:
| Q |
241 |
agtgtgagttcattgcattcatcaaattatgattactctcgagcatagatttctt |
295 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| ||||| |||||| |
|
|
| T |
32835357 |
agtgtgagttcattgcattcatcacattatgatttctctcgaacataggtttctt |
32835303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University