View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15391_low_3 (Length: 250)
Name: NF15391_low_3
Description: NF15391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15391_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 40736041 - 40736282
Alignment:
| Q |
1 |
tgagcaatactcattagctacgggccggttacaccgaagtagaactcagttataaaagggttacaaaaaatgtactcaaggaaaacttcagacatatagc |
100 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736041 |
tgagccatactcattagttacgggccggttacaccgaagtagaactcagttataaaagggttacaaaaaatgtactcaaggaaaacttcagacatatagc |
40736140 |
T |
|
| Q |
101 |
ttagggcgtgt--atacctgcgaggatttgcaaggttacatcagaaaaaataatatagaggtaccgaattgaaagaaaaaatgggcatgtcggagaagga |
198 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736141 |
ttagggcgtgtgtatacctgcgaggacttgcaaggttacatcagaaaaaataatatagaggtaccgaattgaaagaaaaaatgggcatgtcggagaagga |
40736240 |
T |
|
| Q |
199 |
tgtgcttgtatttgctgttattcctatcgtatagttgatgat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736241 |
tgtgcttgtatttgctgttattcctatcgtatagttgatgat |
40736282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University