View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15392_high_2 (Length: 312)
Name: NF15392_high_2
Description: NF15392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15392_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 239 - 297
Target Start/End: Original strand, 36344748 - 36344806
Alignment:
| Q |
239 |
actatagtgtgttagtgtctatgtatatcatagtaattataagctatgatacatgtatt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36344748 |
actatagtgtgttagtgtctatgtatatcattgtaattataagctatgatacatgtatt |
36344806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 36803538 - 36803578
Alignment:
| Q |
113 |
catatcattgataagatcatgaaatattattagtttaataa |
153 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
36803538 |
catatcattgataagatcttaaaatattattaatttaataa |
36803578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University