View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15393_high_29 (Length: 225)
Name: NF15393_high_29
Description: NF15393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15393_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 35817093 - 35817245
Alignment:
| Q |
5 |
agtagttgagatttgagaagaattgaagtcagggatcattgcatttagaacagccccaaatcacggggctgacacaagcttatctcagtttatgtttatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817093 |
agtagttgagatttgagaagaattgaagtcagggatcattgcatttagaacagccccaaatcacggggctgacacaagcttatctcagtttatgtttatt |
35817192 |
T |
 |
| Q |
105 |
tagtatttggtttccatgtgtcatatcttaaacaaattaataagaaatatttg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817193 |
tagtatttggtttccatgtgtcatatcttaaacaaattaataagaaatatttg |
35817245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University