View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15393_low_28 (Length: 248)
Name: NF15393_low_28
Description: NF15393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15393_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 51937083 - 51936849
Alignment:
| Q |
1 |
ttactttcaattagtccttcaaagaaatttcctttcaattagtctcacctctactacannnnnnnnnnnnnnnnnncaattgtgctatcaaattttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
51937083 |
ttactttcaattagtccttcaaagaaatttcctttcaattagtctcacctctactacatttttatttttttttt--caattgtgctatcaaattgtgctt |
51936986 |
T |
 |
| Q |
101 |
tatccattccagctgcatgtagatgcatattgcaggttttctgtcaggacaaccttaggccataaccagatcattatcccattatctatgaagtccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51936985 |
tatccattccagctgcatgtagatgcatattgcaggttttctgtcaggacaaccttaggccataaccagatcat--------tatctatgaagtccaaat |
51936894 |
T |
 |
| Q |
201 |
agggaacacatccgtttgtacatgtagcagatatcgatattcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51936893 |
agggaacacatccgtttgtacatgtagcagatatcgatattcttc |
51936849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University