View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15394_high_29 (Length: 242)
Name: NF15394_high_29
Description: NF15394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15394_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 10881287 - 10881088
Alignment:
| Q |
20 |
gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaatagtattattaattttgactataagtttagtttttctacgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10881287 |
gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaataatattattaattttgactatatatttagtttttctacgtt |
10881188 |
T |
 |
| Q |
120 |
tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtgggagggagagtgggaatctgagtgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10881187 |
tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtg----ggagagtgggaatctgagtgg |
10881092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University