View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15394_high_34 (Length: 226)
Name: NF15394_high_34
Description: NF15394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15394_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 47570989 - 47571184
Alignment:
| Q |
14 |
cataggctaattattaatgaatataataaccacgatgagattggaaatggaaagatgcatatatatgtatacttgagggaatcaagaagtgaaagatggg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47570989 |
cataggctaattattaatgaatataataaccacgatgagattggaaatggaaagatgcatatatatgtatacttgagggaatcaagaagtgaaagatggg |
47571088 |
T |
 |
| Q |
114 |
actttgaaatattgtcaactagtggcttggatttattctataagatggacccgtcttataacaattttacctatgtgcgtgtgtttgtgactttgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47571089 |
actttgaaatattgtcaactagtggcttggatttattctataagatggacccgtcttataacaattttacctatgtgcgtgtgtttgtgactttgt |
47571184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University