View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15394_low_23 (Length: 320)
Name: NF15394_low_23
Description: NF15394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15394_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 12 - 320
Target Start/End: Complemental strand, 2443983 - 2443675
Alignment:
| Q |
12 |
agttagtttggtgtccgtaattgaatttagtttgttttggtggtgaaggaagtatccacgtcacgtcactcagcatcaaccaattgtttctttctttctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443983 |
agttagtttggtgtccgtaattgaatttagtttgttttggtggtgaaggaagtatccacgtcacgtcactcagcatcaaccaattgtttctttctttctt |
2443884 |
T |
 |
| Q |
112 |
tcttccaaacttgtcattacgatacatgcattcaagaaaaacagtgaaattttcagaatacgaagaaacaatgagaagaagaatctggagtcttctctcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443883 |
tcttccaaacttgtcattacgatacatgcatccaagaaaaacagtgaaattttcagaatacgaagaaacaatgagaagaagaatctggagtcttctctcc |
2443784 |
T |
 |
| Q |
212 |
aacaaaaacaaactcacatttccaatcccaatctccaattcccgcgtaattccgtttctttcttactgcaccgatccatcacgtattctcaaccataacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443783 |
aacaaaaacaaactcacatttccaatcccaatctccaattcccgcgtaattccgtttctttcttactgcaccgatccatcacgtattctcaaccataacc |
2443684 |
T |
 |
| Q |
312 |
atccaggtt |
320 |
Q |
| |
|
||||||||| |
|
|
| T |
2443683 |
atccaggtt |
2443675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University